diff options
Diffstat (limited to 'benchmark/so_k_nucleotide.yml')
-rw-r--r-- | benchmark/so_k_nucleotide.yml | 155 |
1 files changed, 155 insertions, 0 deletions
diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml new file mode 100644 index 0000000000..d7df086c39 --- /dev/null +++ b/benchmark/so_k_nucleotide.yml @@ -0,0 +1,155 @@ +prelude: | + bm_so_fasta = <<'EOS' + # The Computer Language Shootout + # http://shootout.alioth.debian.org/ + # Contributed by Sokolov Yura + + $last = 42.0 + def gen_random(max, im=139968, ia=3877, ic=29573) + (max * ($last = ($last * ia + ic) % im)) / im + end + + alu = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+ + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+ + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+ + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+ + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+ + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+ + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" + + iub = [ + ["a", 0.27], + ["c", 0.12], + ["g", 0.12], + ["t", 0.27], + + ["B", 0.02], + ["D", 0.02], + ["H", 0.02], + ["K", 0.02], + ["M", 0.02], + ["N", 0.02], + ["R", 0.02], + ["S", 0.02], + ["V", 0.02], + ["W", 0.02], + ["Y", 0.02], + ] + homosapiens = [ + ["a", 0.3029549426680], + ["c", 0.1979883004921], + ["g", 0.1975473066391], + ["t", 0.3015094502008], + ] + + def make_repeat_fasta(id, desc, src, n) + puts ">#{id} #{desc}" + v = nil + width = 60 + l = src.length + s = src * ((n / l) + 1) + s.slice!(n, l) + puts(s.scan(/.{1,#{width}}/).join("\n")) + end + + def make_random_fasta(id, desc, table, n) + puts ">#{id} #{desc}" + rand, v = nil,nil + width = 60 + chunk = 1 * width + prob = 0.0 + table.each{|v| v[1]= (prob += v[1])} + for i in 1..(n/width) + puts((1..width).collect{ + rand = gen_random(1.0) + table.find{|v| v[1]>rand}[0] + }.join) + end + if n%width != 0 + puts((1..(n%width)).collect{ + rand = gen_random(1.0) + table.find{|v| v[1]>rand}[0] + }.join) + end + end + + + n = (ARGV[0] or 250_000).to_i + + make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2) + make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3) + make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5) + EOS +benchmark: + - name: so_k_nucleotide + prelude: | + script = File.join(File.dirname($0), 'bm_so_fasta.rb') + File.write(script, bm_so_fasta) + + def prepare_fasta_output n + filebase = File.join(File.dirname($0), 'fasta.output') + script = File.join(File.dirname($0), 'bm_so_fasta.rb') + file = "#{filebase}.#{n}" + + unless FileTest.exist?(file) + STDERR.puts "preparing #{file}" + + open(file, 'w'){|f| + ARGV[0] = n + $stdout = f + load script + $stdout = STDOUT + } + end + end + prepare_fasta_output(100_000) + script: | + # The Computer Language Shootout + # http://shootout.alioth.debian.org + # + # contributed by jose fco. gonzalez + # modified by Sokolov Yura + + seq = String.new + + def frecuency( seq,length ) + n, table = seq.length - length + 1, Hash.new(0) + f, i = nil, nil + (0 ... length).each do |f| + (f ... n).step(length) do |i| + table[seq[i,length]] += 1 + end + end + [n,table] + + end + + def sort_by_freq( seq,length ) + n,table = frecuency( seq,length ) + a, b, v = nil, nil, nil + table.sort{|a,b| b[1] <=> a[1]}.each do |v| + puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)] + end + puts + end + + def find_seq( seq,s ) + n,table = frecuency( seq,s.length ) + puts "#{table[s].to_s}\t#{s.upcase}" + end + + input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb') + + line = input.gets while line !~ /^>THREE/ + line = input.gets + + while (line !~ /^>/) & line do + seq << line.chomp + line = input.gets + end + + [1,2].each {|i| sort_by_freq( seq,i ) } + + %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) } + loop_count: 1 |